Apollo¶

GBrowse¶

GBrowse was one of the earlier genome browsers, and continues to have wide popularity as it handles massive datasets quite well.

Fig. 25 Screenshot of GBrowse from GMOD Wiki

Tracks are rendered on the server, and the client view the genome and datasets through a set of static images shown to the user.

JBrowse¶

JBrowse and GBrowse are related and attempt to solve the same problem, JBrowse is a more modern, javascript version that does all of the processing on the client. This can make JBrowse much more responsive to user interactions, like how Google Maps was an improvement over previous web maps which required you to click and the page to refresh to load a new section of the map.

Fig. 26 Screnshot of a JBrowse instance. In this figure, JBrowse is shown displaying some alignments of sequencing reads to a genome. JBrowse has the ability to do things like dynamically colouring reads based on multiple properties, include read quality and direction.

JBrowse automatically has generated both a sequencing depth track (blue) and a set of individual reads. Neither of these tracks were pre-computed.

Many labs have deployed JBrowse instances to help showcase their annotation efforts to the community, and to make their data accessible. Here you can see a demonstration of Drosophila melanogaster genes from FlyBase in JBrowse and play around with it.

Note that JBrowse is a static visualization tool, you cannot make any changes to the data, you cannot provide annotation and save them. It is a “Read Only” view of genomes and annotations.

Apollo¶

Apollo takes JBrowse one step further and adds infrastructure for community annotation; it provides a “Read+Write” view of genomes. You can create new gene features, new annotations on those features, and these are shared with everyone who has access to the Apollo server.

Apollo embeds JBrowse, so if you are familiar with JBrowse, many of the same skills apply.

Fasta¶

Many of you may have seen a fasta formatted sequence before, but briefly it looks like:

>phiX  Complete genome sequence of phage X
ACTGACTGATCGACTGCGTACGATCGACTGACT
CTGCGTACGATCGACTGACTACTGACTGATCGA
...

Each sequence starts with a >, and has a “fasta ID” after it. Some sequences have a “description” after the sequence, like the in the above “Complete genome...”

The sequences contained within a fasta file may be DNA, RNA, or protein sequences.

GFF3¶

Eukaryotic Gene Model

Fig. 27 This model is used by GFF3 and eukaryotic annotation efforts. Prokaryotic annotations may exhibit differences. Many organisations also use different standards and subsets of GFF3.

Many of you are probably familiar with the eukaryotic gene model. This model captures a lot of information about the biological process behind producing proteins from DNA, such as mRNAs, transcription, and alternative splicing. GFF3 files thus have to encode these complex, hierarchical, parent-child relationships.

Let’s look at what a GFF3 file looks like, briefly:

##gff-version 3.2.1
##sequence-region   ctg123 1 1497228
ctg123 . gene            1000  9000  .  +  .  ID=gene00001;Name=EDEN

ctg123 . mRNA            1050  9000  .  +  .  ID=mRNA00001;Parent=gene00001;Name=EDEN.1

ctg123 . exon            1201  1500  .  +  .  ID=exon00002;Parent=mRNA00001
ctg123 . exon            3000  3902  .  +  .  ID=exon00003;Parent=mRNA00001
ctg123 . exon            5000  5500  .  +  .  ID=exon00004;Parent=mRNA00001
ctg123 . exon            7000  9000  .  +  .  ID=exon00005;Parent=mRNA00001

ctg123 . CDS             1201  1500  .  +  0  ID=cds00001;Parent=mRNA00001;Name=edenprotein.1
ctg123 . CDS             3000  3902  .  +  0  ID=cds00001;Parent=mRNA00001;Name=edenprotein.1
ctg123 . CDS             5000  5500  .  +  0  ID=cds00001;Parent=mRNA00001;Name=edenprotein.1
ctg123 . CDS             7000  7600  .  +  0  ID=cds00001;Parent=mRNA00001;Name=edenprotein.1

And the visual representation of the text

At the top level we see a “gene” (3rd column), which spans from 1000 to 9000, on the forward strand (7th column), with an ID of gene00001 and a Name of EDEN.

Below the gene, is an mRNA feature. We can infer that it is “below” in the hierarchy based on the last column which has a Parent of gene00001. Similarly all four exons and all four CDSs have a Parent of mRNA00001. ID, Name, and Parent are all known as feature attributes. Metadata about a feature. However, more information than just the names, IDs, and relationships goes into feature attributes. Often you will see Notes, sometimes Products, and many other tags besides. Only a couple of these attributes have standards defining what information they contain, the rest are free to be used as your organisation specifies, or as you like.

All of this is a little bit excessive for phages where real introns are rare, and mRNAs not involved, but nevertheless, we want to make sure our data is accessible to other researchers so they can do experiments building on our work.

(It is more important that you know the format exists, and that it encodes parent-child biological relationships, than that you know the precise specifics of what each column means.)

GenBank¶

In stark contrast to the elegance of the GFF3 format (tab separated, key-value pairs, easy to work with), we have the older GenBank format. This is a fixed-width format which has a “flat” gene model, and lacks any way to represent the hierarchical relationships that are biologically relevant.

LOCUS       NC_001133             230218 bp    DNA     linear   PLN 14-JUL-2011
DEFINITION  Saccharomyces cerevisiae S288c chromosome I, complete sequence.
ACCESSION   NC_001133
VERSION     NC_001133.9  GI:330443391
DBLINK      Project: 128
KEYWORDS    .
SOURCE      Saccharomyces cerevisiae S288c
  ORGANISM  Saccharomyces cerevisiae S288c
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 230218)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
FEATURES             Location/Qualifiers
     source          1..230218
                     /organism="Saccharomyces cerevisiae S288c"
                     /mol_type="genomic DNA"
                     /strain="S288c"
                     /db_xref="taxon:559292"
                     /chromosome="I"
     gene            complement(1807..2169)
                     /gene="PAU8"
                     /locus_tag="YAL068C"
                     /db_xref="GeneID:851229"
     mRNA            complement(<1807..>2169)
                     /gene="PAU8"
                     /locus_tag="YAL068C"
                     /transcript_id="NM_001180043.1"
                     /db_xref="GI:296142466"
                     /db_xref="GeneID:851229"
     CDS             complement(1807..2169)
                     /gene="PAU8"
                     /locus_tag="YAL068C"
                     /note="hypothetical protein, member of the seripauperin
                     multigene family encoded mainly in subtelomeric regions"
                     /codon_start=1
                     /protein_id="NP_009332.1"
                     /db_xref="GI:6319249"
                     /db_xref="SGD:S000002142"
                     /db_xref="GeneID:851229"
...
ORIGIN
        1 ccacaccaca cccacacacc cacacaccac accacacacc acaccacacc cacacacaca
       61 catcctaaca ctaccctaac acagccctaa tctaaccctg gccaacctgt ctctcaactt

There are a few major regions of a GenBank file:

1. The header (Starting with LOCUS...)
2. The feature table (Starting with FEATURES)
3. The sequence

The header will tell you information like:

• Sequence ID, NC_001133 in the above example,
• Genome or chromosome length
• Annotation set version (9, from VERSION NC_001133.9)
• References

The feature table usually starts with a “source” type feature which contains metadata about the chromosome or genome. Features consist of a feature type key on the left, and key value pairs on the right formatted as /key="Value...".

Lastly, there is the sequence data. In contrast to GFF3 which stores sequence data in standardised fasta format, GenBank uses sequence separated into six columns of ten characters, with the sequence index annotated on the left.

Registration¶

In order to log in to Apollo, you’ll need to register for an account using the Galaxy tool, if your site has not already set up one for you.

In the integrated Galaxy-Apollo workflow, you can register for an account by running a Galaxy tool, which will generate your credentials for you. If you ever forget your credentials and cannot find the item in your history, you can re-run this, and it will generate a new password for you.

Simply fill out the form:

And hit the Execute button. Once the tool is done running, the dataset will turn green. You will then click the “View Dataset” eyeball button to see your password. (You don’t need to memorize this password or write it down anywhere. You can always come back to Galaxy to view it.)

Fig. 29 If you ever lose your Galaxy history with the password, just come back to Galaxy and re-run the tool. The password will be saved there for you.

JBrowse In Galaxy¶

If you’re familiar with JBrowse, a view of Apollo should look familiar to you:

Fig. 30 Notice the JBrowse window embedded within the Apollo interface. Apollo integrates with the JBrowse software to provide the ability to make annotations and save them.

The CPT developed a tool called JBrowse-in-Galaxy (JiG) which allows you to build JBrowse instances within Galaxy. JBrowse instances are traditionally configured through a complex and manual process at the command line. JiG represents the first ever visual JBrowse configuration and construction tool.

Fig. 31 The generalized JBrowse workflow. JBrowse is simply a tool for displaying the results of a bioinformatic analysis in a standardised way.

Apollo takes, as its input, complete JBrowse instances. To view any data in Apollo, a JBrowse instance needs to be configured first.

Fig. 32 The JBrowse-in-Galaxy tool is an extremely complex tool, with a very detailed manual (at the bottom of the page in Galaxy). If you need to do anything beyond showing simple GFF3 files, you’ll need to read this manual.

If you just wish to display the genome and associated datasets in Apollo, you do not need to produce a “standalone instance.” That is only required if you wish to view the (static) JBrowse instance in Galaxy.

Once you’ve created a JBrowse instance, you’ll find it in your history

Fig. 33 Viewing a JBrowse instance produced within Galaxy.

If you chose to produce a “standalone instance,” you’ll be able to click the eyeball icon and view the dataset.

Moving Data from Galaxy to Apollo¶

Now that you have:

1. A complete JBrowse instance
2. Apollo credentials

You’re ready to start talking to the Apollo service.

Fig. 34 The general Apollo/JiG/Galaxy workflow. Data is built up in Galaxy in the form of a JBrowse instance, which is pushed to the Apollo service in the Create or Update step, and transfers data to Apollo. The Annotate step is simple a convenience method for accessing Apollo. Apollo is also available at https://your-organisations-galaxy-instance/apollo. These methods both point at the same instance of Apollo.

The first tool we’ll use is a tool named Create or Update which lets us create, or update, an organism in Apollo with new data from Galaxy in the form of a JBrowse instance.

Fig. 35 It is not required (but highly recommended) to fill out the species field appropriately. Additionally it is not required to make anything public (available to the public at large) but it is encouraged.

This step will transfer data to Apollo, and produce a JSON file. The output JSON file contains some metadata about the organism. You will never need any information from this file.

Now that your data is available in Apollo, you can access it at Apollo, or via the Annotate convenience method which is provided. The Annotate tool takes the JSON file from a Create or Update step, and loads Apollo, directly in Galaxy.

Fig. 36 Apollo accessed from within Galaxy